Особенности экспрессии изоформ мрнк лейкемия-ингибирующего фактора и фактора стволовых клеток в фетальных тканях и мононуклеарных клетках человека на разных стадиях онтогенеза 14. 03. 09 «Клиническая иммунология, аллергология» icon

Особенности экспрессии изоформ мрнк лейкемия-ингибирующего фактора и фактора стволовых клеток в фетальных тканях и мононуклеарных клетках человека на разных стадиях онтогенеза 14. 03. 09 «Клиническая иммунология, аллергология»





Скачать 307.81 Kb.
НазваниеОсобенности экспрессии изоформ мрнк лейкемия-ингибирующего фактора и фактора стволовых клеток в фетальных тканях и мононуклеарных клетках человека на разных стадиях онтогенеза 14. 03. 09 «Клиническая иммунология, аллергология»
САДОВСКАЯ ВЕРА АНАТОЛЬЕВНА
Дата03.04.2013
Размер307.81 Kb.
ТипАвтореферат
На правах рукописи


САДОВСКАЯ ВЕРА АНАТОЛЬЕВНА


Особенности экспрессии изоформ мРНК лейкемия-ингибирующего фактора и фактора стволовых клеток в фетальных тканях и мононуклеарных клетках человека на разных стадиях онтогенеза


14.03.09 «Клиническая иммунология, аллергология»


АВТОРЕФЕРАТ

Диссертации на соискание ученой степени

кандидата медицинских наук


Новосибирск 2013

Работа выполнена в Федеральном государственном бюджетном учреждении «Научно-исследовательский институт клинической иммунологии» Сибирского отделения Российской академии медицинских наук

^ Научный руководитель:

Доктор медицинских наук, профессор Сенников Сергей Витальевич

Официальные оппоненты:

Суховей Юрий Геннадьевич, доктор медицинских наук, профессор, Тюменский филиал Федерального Государственного Бюджетного Учреждения "Научно-исследовательский институт клинической иммунологии» Сибирского отделения Российской академии медицинских наук, директор

^ Шурлыгина Анна Вениаминовна, доктор медицинских наук, профессор, Федеральное государственное бюджетное учреждение «Научно-исследовательский институт физиологии» Сибирского отделения Российской академии медицинских наук, ведущий научный сотрудник лаборатории хронофизиологии

^ Ведущая организация:

Федеральное государственное бюджетное учреждение «Научно-исследовательский институт фармакологии» Сибирского отделения Российской академии медицинских наук (г. Томск)

Защита состоится «__»_________2013 г. В ___ часов на заседании диссертационного совета Д001.001.01 в ФГБУ «НИИ клинической иммунологии» СО РАМН по адресу: 630099, г. Новосибирск, ул. Ядринцевская, 14.

С диссертацией можно ознакомиться в библиотеке ФГБУ «НИИ клинической иммунологии» СО РАМН

Автореферат разослан «___»_________________2013г.


Ученый секретарь диссертационного совета

Кандидат медицинских наук Белогородцев Сергей Николаевич

^ ОБЩАЯ ХАРАКТЕРИСТИКА РАБОТЫ

Актуальность темы. В последнее время широко изучается значение альтернативного сплайсинга в иммунопоэзе в норме и при патологии. Определяется роль изоформ мРНК цитокинов в развитии не только иммунной системы, но и функционировании других систем организма. Например, показано значение и возможности коррекции патологии репродукции с помощью таких цитокинов, как LIF, IL-11 [Dimitriadis, 2007]. Многие аутоиммунные процессы связаны с изменением альтернативного сплайсинга вовлеченных в патогенез белков [Evsyukova, 2010]. Несомненно, является важным изучение особенностей альтернативного сплайсинга цитокинов, участвующих в развитии иммунной системы и органогенеза на ранних этапах развития, чтобы расширить представления о значении, распространении альтернативного сплайсинга в этих процессах, найти возможности поиска ранних маркеров нарушений развития. В настоящее время разрабатываются подходы специфической терапии, направленной на коррекцию процессинга мРНК при различных заболеваниях с использованием олигонуклеотидов, РНК-интерференции и других молекулярно-генетических методов, для чего тоже необходимо знание особенностей экспрессии изоформ мРНК.

Одними из основных факторов, участвующих в регуляции раннего иммунопоэза, являются лейкемия-ингибирующий фактор (LIF) и фактор стволовых клеток (SCF). Оба эти фактора играют важнейшую роль в пролиферации и созревании иммунокомпетентных клеток в печени, тимусе, костном мозге, а так же в процессах органогенеза. Эти цитокины являются основными медиаторами поддержания плюрипотентности эмбриональных стволовых клеток [Kristensen, 2005; Hirai, 2011].

В различных исследованиях была показана роль LIF в поддержании плюрипотентности и пролиферации эмбриональных стволовых клеток, в пролиферации тимоцитов, в регуляции количества миелоидных предшественников в костном мозге, активации гипоталамо-гипофизарно-адреналовой системы, при воспалении, стрессе и травме, в поддержании функций моторных нейронов, регуляции функций остеобластов [Escary, 1993; Patterson, 1994, Hirai, 2011; Sims, 2012]. При изучении процессов регуляции дифференцировки CD4+ клеток в разные классы Т-хелперов было показано, что LIF стимулирует образование регуляторных Т-клеток и подавляет индуцированную IL-6 продукцию IL-17 в Тх17, что является основой применения его рекомбинантных форм в терапии аутоиммунных заболеваний [Gao, 2009; Metcalfe, 2011]. Показано, что в тимусе уровень мРНК LIF, других цитокинов семейства IL-6 и SCF повышается с возрастом и коррелирует со снижением количества TREC в клетках тимуса. Предположительно, LIF и SCF участвуют в регуляции процессов инволюции тимуса [Sempowski, 2000]. В дополнении к этому LIF играет важную роль в образовании децидуальной ткани в эндометрии и имплантации, используется при лечении бесплодия [Dimitriadis, 2007]. Однако неясным остается, какова роль отдельных изоформ мРНК LIF в описанных процессах. При изучении экспрессии LIF у млекопитающих в различных тканях in vitro и in vivo было показано, что в результате транскрипции гена lif могут получаться три продукта. Эти транскрипты содержат альтернативные первые экзоны, соединенные с идентичными вторым и третьим экзонами [Rathjen, 1990]. Основные исследования экспрессии изоформ мРНК LIF проводились на мышах и клеточных линиях. Анализ транскриптов hLIF в культурах клеток человека выявил значительную вариабельность в профилях экспрессии. Исследований экспрессии сплайс-вариантов мРНК LIF у человека в период внутриутробного развития ранее не проводилось. Есть данные лишь об экспрессии LIF в фетальных яичниках человека [Abir, 2004]. Данные об экспрессии изоформ LIF могли бы прояснить характер альтернативного сплайсинга LIF человека в период раннего иммунопоэза прежде всего в таких органах, как тимус, селезенка и печень. Это необходимо для дальнейшего изучения регуляции альтернативного сплайсинга этого цитокина, изучения изменений спектра изоформ при различных патологических состояниях и изучения функциональных особенностей изоформ.

Другим важным фактором роста является фактор стволовых клеток (stem cell factor, SCF). Анализ экспрессии гена scf в развивающихся эмбрионах показал, что этот цитокин играет важную и разнообразную роль в онтогенезе иммунной системы и кроветворения. SCF так же экспрессируется в компартментах развития стволовых кроветворных клеток и участвует в регуляции развития, пролиферации и миграции клеток иммунопоэза, меланоцитов и половых клеток [Sette, 2000; Toksoz, 1992]. Экспрессия SCF наблюдается в стромальных и добавочных клетках из микроокружения гематопоэтических клеток, включая клетки эндотелия, моноциты, фибробласты. Вместе с LIF SCF является необходимым фактором для раннего развития Т-лимфоцитов [Liu, 2012]. Особую роль играет SCF в В-лимфопоэзе. Он участвует в регуляции ранних этапов развития В-клеток. Известна способность SCF усиливать пролиферацию незрелых дендритных клеток in vitro. В присутствии SCF и IL-2 из CD34+ клеток образуются НК-клетки [Anderson, 1990; Broudy, 1997; Takatsu, 1997; Ashman, 1999]. Белок SCF человека синтезируется в двух формах – мембранно-ассоциированной и растворимой. Эти изоформы образуются из двух сплайсированных мРНК, в одной из которых отсутствует шестой экзон. В большинстве исследований особенности экспрессии изоформ мРНК SCF человека изучались на клеточных линиях и в тканях во взрослом периоде в норме и при различных патологиях [Smith, 2001; Reber, 2006; Krasaqakis, 2011; Menq, 2012]. Было показано, что изоформы обладают разной биологической активностью [Miyazawa, 1995; Mauduit, 1999; Hutt, 2006]. Остаются неясными особенности синтеза разных изоформ мРНК SCF и их значение на этапе внутриутробного развития человека, когда наблюдается высокая активность экспрессии этого фактора при процессах органогенеза, раннего иммунопоэза.

Представляется актуальным изучить особенности экспрессии сплайс-изоформ этих двух ростовых факторов в тканях человека, участвующих в формировании гемо- и иммунопоэза во внутриутробном периоде, и определить изменения в спектре экспрессии изоформ в мононуклеарных клетках крови в течение онтогенеза.

^ Цель исследования. Изучить экспрессию сплайс-вариантов мРНК лейкемия-ингибирующего фактора и фактора стволовых клеток в фетальных тканях человека и в мононуклеарных клетках периферической крови на разных этапах онтогенетического развития.

^ Задачи исследования:

1. Определить наличие сплайс-вариантов мРНК лейкемия-ингибирующего фактора в образцах фетальных тканей человека.

2. Выявить наличие и спектр экспрессии сплайс-вариантов мРНК лейкемия-ингибирующего фактора в мононуклеарных клетках периферической крови человека в пренатальный, неонатальный и постнатальный этапы развития.

3. Исследовать экспрессию сплайс-вариантов мРНК фактора стволовых клеток в различных фетальных тканях человека.

4. Изучить изменения экспрессии сплайс-вариантов мРНК фактора стволовых клеток в мононуклеарных клетках периферической крови человека на разных этапах онтогенетического развития: пренатальном, неонатальном и во взрослом периоде.

^ Научная новизна. Впервые изучен тканеспецифический характер экспрессии изоформ мРНК LIF в различных фетальных тканях человека. В тканях, участвующих в формировании гемо- и иммунопоэза (печень, селезенка и тимус), выявлены достоверные различия в экспрессии изоформ. Так, в печени, являющейся центральным органом гемопоэза во внутриутробном периоде, обнаружена высокая частота встречаемости экспрессии обоих сплайс-вариантов мРНК LIF, в селезенке экспрессия изоформ встречалась со средней частотой и определялась только мембранная изоформа мРНК LIF-M, в тимусе частота встречаемости экспрессии LIF была низкой и определялась только растворимая форма мРНК LIF-D.

В работе впервые охарактеризован спектр экспрессии изоформ мРНК LIF в мононуклеарных клетках крови человека в разные периоды онтогенетического развития. Показано достоверное снижение частоты встречаемости экспрессии изоформ мРНК LIF в мононуклеарных клетках крови новорожденных по сравнению с клетками плодов 22-х недель гестации. У взрослых доноров экспрессии не выявлено.

Впервые показан спектр экспрессии изоформ мРНК SCF в различных типах тканей на этапе внутриутробного развития человека. Это дополняет имеющиеся данные об экспрессии изоформ мРНК SCF в тканях во взрослом периоде развития. Впервые продемонстрирована стадиеспецифичность для экспрессии изоформ мРНК SCF в мононуклеарных клетках периферической крови человека на разных этапах развития. Частота встречаемости экспрессии изоформ мРНК SCF в этих клетках снижается от пренатального периода к неонатальному и исчезает во взрослом периоде развития.

^ Теоретическая и практическая значимость работы. В работе продемонстрировано, что экспрессия генов цитокинов LIF и SCF в фетальных тканях человека происходит с участием альтернативного сплайсинга. При этом наблюдается тканеспецифический характер экспрессии. Полученные результаты изучения экспрессии генов цитокинов позволяют расширить представления о полиморфизме цитокиновой сети. Показанные в работе факты экспрессии генов LIF и SCF человека в виде нескольких изоформ предоставляют новые данные об особенностях альтернативного сплайсинга этих цитокинов в период внутриутробного развития и в течение онтогенеза человека. Данные о тканеспецифическом и стадиеспецифическом характере экспрессии этих ростовых факторов у человека позволяют дифференцировать подходы к применению их рекомбинантных форм в терапии, учитывая характер альтернативного сплайсинга мРНК.

^ Положения, выносимые на защиту:

1. Экспрессия генов цитокинов lif и scf в фетальных тканях и мононуклеарных клетках периферической крови человека происходит с участием альтернативного сплайсинга.

2. Экспрессия изоформ мРНК цитокинов LIF и SCF человека имеет тканеспецифический и стадиеспецифический характер в онтогенезе.

^ Апробация материалов диссертации.

Материалы диссертации доложены и обсуждены на: 1) Межрегиональной научно-практической конференции «Дни иммунологии в Сибири» (Омск, 2007 г.); 2) Всероссийской научной конференции "Объединенный Иммунологический Форум" (Санкт-Петербург, 2008 г.). Апробация диссертации состоялась 26 октября 2012 г. на семинаре ФГБУ «НИИ клинической иммунологии» СО РАМН.

Публикации. По материалам диссертации опубликовано 4 печатных работы, в том числе 2 статьи в журналах, рекомендованных ВАК для публикации результатов работ соискателей ученой степени кандидата наук.

^ Объем и структура диссертации. Диссертация написана в традиционном стиле и состоит из введения, обзора литературы, описания материалов и методов исследования, описания собственных исследований, обсуждения полученных результатов, заключения и выводов. Материал изложен на 137 страницах машинописного текста, включающего 2 рисунка и 10 таблиц. Прилагаемая библиография содержит ссылки на 175 литературных источников, в том числе 168 зарубежных. Работа выполнена на базе лаборатории молекулярной иммунологии ФГБУ «НИИ клинической иммунологии» СО РАМН.

^ МАТЕРИАЛЫ И МЕТОДЫ ИССЛЕДОВАНИЯ

Фетальные ткани и кровь плодов человека. В работе исследовали фетальные ткани (печени (n=7), селезенки (n=5), тимуса (n=6), яичников (n=5), семенников (n=4), почки (n=5), мозга (n=7), надпочечников (n=3) и зачатков зубов (n=3)) и кровь плодов (n=12) от относительно здоровых женщин (средний возраст 26 ± 3 лет), у которых беременность была прервана по социальным показаниям (средний срок гестации составил 20-22 недели). Прерывание беременности индуцировали путем интраамниального введения 25мг энзапроста. Отсутствие внутриутробной инфекции (герпес, гепатиты В и С, цитомегаловирус, и т.д.) у плода было подтверждено результатами бактериологического и гистологического исследования абортивного материала и последа. Образцы предоставлены из банка биоматериалов лаборатории клеточных биотехнологий (зав. лабораторией д.м.н. Селедцова Г.В.). Образцы тканей замораживались и хранились в жидком азоте. Кровь плодов собиралась в пробирки с 1 мл 0,5М ЭДТА.

^ Пуповинная кровь новорожденных. В исследование были включены женщины, у которых беременность завершилась срочными, самопроизвольными родами. Пуповинную кровь здоровых, доношенных новорожденных (n=13) в объеме 5-7 мл получали после пересечения пуповины, когда плацента еще находилась в полости матки (in uteri). Для этого дренировали пупочную вену, и кровь самотеком поступала в стерильную пробирку с 700 мкл 0,5 М ЭДТА.

Все исследования с фетальными тканями и плодовой/пуповинной кровью были одобрены Локальным этическим комитетом и проводились при наличии информированного согласия пациентов (номер протокола №72 от 26.09.2012г.).

^ Мононуклеарные клетки периферической крови человека. Источником мононуклеарных клеток (МНК) послужила венозная кровь доноров, пуповинная кровь новорожденных и кровь из сердца плодов на 20-22 неделях развития. МНК выделяли стандартным методом центрифугирования в градиенте плотности фиколл-урографина (ρ=1,082 г/л; фиколл (Pharmacia Fine Chemicl, Sweden), урографин (Шеринг АО, Германия)). Для этого 5 мл крови наслаивали на 3 мл раствора фиколл-урографина и центрифугировали при 3000 об/мин в течение 20 мин [30]. МНК, собранные из интерфазы, отмывали средой RPMI-1640 (ГНЦ ВБ «Вектор», г. Новосибирск) 3 раза путем ресуспендирования и последующего центрифугирования при 1000 оборотов/мин в течение 10 минут.

^ Выделение суммарной клеточной РНК. Суммарную РНК из фетальных тканей (печени (n=7), селезенки (n=5), тимуса (n=6), яичников (n=5), семенников (n=4), почки (n=5), мозга (n=7), надпочечников (n=3) и зачатков зубов (n=3)) выделяли методом фенольной экстракции. Образцы тканей растирали в ступке с жидким азотом до образования порошкообразной массы. Затем небольшое количество порошка (около 30-40 мкг) быстро переносили в стеклянные гомогенизаторы с денатурирующим раствором (4 М гуанидин тиоцианат (Fluka, Switzerland), 25 мМ цитрат натрия, рН 7,0; 0,5% саркозил (Sigma, USA); 0,1 М 2-βмеркаптоэтанол (Fluka, Switzerland)) и интенсивно гомогенизировали в течение 5-7 минут. Из полученного лизата отбирали 500 мкл и дальше выделяли РНК по стандартному протоколу. Свежевыделенные мононуклеарные клетки лизировали денатурирующим раствором из расчета 100 мкл денатурирующего раствора на 1Х106 клеток. К лизату последовательно добавляли 0,1 объема 2 М ацетата натрия (рН 4,0); 1 объем насыщенного водой фенола и 0,2 объема смеси хлороформ:изоамиловый спирт (49:1). Перед добавлением очередного компонента лизат тщательно перемешивали, переворачивая пробирки. Конечную суспензию интенсивно встряхивали на шейкере в течение 15 секунд, затем инкубировали на льду 30 мин. После инкубирования образцы центрифугировали для разделения фаз 20 мин при 12000 об/мин. Водную фазу отбирали, добавляли к ней равный объем изопропанола и помещали на -20°С для преципитации РНК. После повторного центрифугирования в течение 20 мин. при 12000 об/мин получившийся осадок РНК дважды отмывали в 75% этаноле. Осадок растворяли в деионизованной воде обработанной диэтилпирокарбонатом (0,01%) (Serva, Germany).

Качество выделенной РНК оценивали с помощью электрофореза в 1% агарозном геле (Chemapol, Чехия), приготовленном на трис-ацетатном буфере. Концентрацию и чистоту РНК оценивали на спектрофотометре "Милихром" при длинах волн 260 и 280 нм.

^ Реакция обратной транскрипции (ОТ). 10 мкл суммарной РНК денатурировали в присутствии 0,5мкг универсального праймера oligo(dT)16 при 70°С 5 минут и переносили на лед. Реакционная смесь содержала 10 мкл суммарной РНК, 0,5мкг oligo(dT)16 (Биосан, Новосибирск), 500 мкМ каждого dNTP (Sigma, USA), 25ед - M-MuLV обратной транскриптазы (Биосан, Новосибирск). Реакционный буфер прилагался к обратной транскиптазе и содержал 2 мM MnCl2, 20мМ Трис-HCI (рН 8,3 при 25°С), 100мM KCI, 1мМ дитиотрейтол (ДТТ). Реакцию проводили в объеме 20 мкл в течение 1,5 часов при 37°С, денатурировали фермент при 95°С 5 минут. Хранили полученные образцы кДНК при -20° С. Чтобы проконтролировать прохождение реакции ОТ с полученным продуктом и неревертированной РНК проводили ПЦР с праймеров, специфичных к последовательности гена GAPDH.

^ Полимеразная цепная реакция (ПЦР). ПЦР проводили в амплификаторе “PTC-200 DNA Engine” (MJ Research inc., USA). Реакционная смесь в объеме 20 мкл содержала 2 мкл смеси после реакции обратной транскрипции, 2 ед. Taq-ДНК полимеразы (Сибэнзим, Новосибирск), 0,5 мкМ каждого из праймеров, 250 мкМ смеси четырех dNTP. Реакционный буфер прилагался к ДНК-полимеразе и содержал 60мМ трис-НС1 (рН= 8,5 при 25° С), 100 мМ KCl, 1,5 мМ MgCl2, 10мМ 2-меркаптоэтанола, 1мM ДТТ. Режим термоциклирования зависел от состава праймеров и длины амплифицируемого фрагмента и рассчитывался с использованием программ «Primer Premier 5.0» и «Vector NTI 9.0»

Для повышения специфичности метода проводилась вложенная ПЦР с 1мкл смеси после первичной амплификации с другой парой праймеров. Продукты амплификации анализировали с помощью электрофореза в 1,5 или 2% агарозном геле, приготовленном на трис-ацетатном буфере (ТАЕ). В качестве маркера молекулярного веса использовали гидролизат плазмиды pUC19, полученный при расщеплении рестриктазой MspI (СибЭнзим, Новосибирск), негативными контролями служили препараты «неревертированной РНК» и реакция «без матрицы». После проведения электрофореза гель окрашивали водным раствором бромистого этидия (0,5 мкг/мл). Продукты полимеразной цепной реакции визуализировали в ультрафиолетовом свете, молекулярный вес фрагментов и интегральная оптическая плотность бэндов (IOD) оценивалась с помощью видеоденситометра и пакета прикладных программ “ImageMaster&VDS”(Pharmacia Biotech, USA).

Праймеры к последовательности гена GAPDH, LIF-D, LIF-M, LIF-T были синтезированы в фирме «Биосан», г. Новосибирск. Структура праймеров и термопрофили для первичной ПЦР были следующие:

LIF-D: 5’ – ataatgaaggtcttggcggcag

5’ – cggcgatgatctgcttatactt

Условия ПЦР: 95°C – 3 мин, 95°C – 20 сек, 63°C – 20 сек, 72°C – 30 сек, 40 циклов, 72°C – 3 мин, 25°C – 10 сек.

LIF-M: 5’ – ctggaagcgtgtggtctg

5’ – cggcgatgatctgcttatactt

Условия ПЦР: 95°C – 3 мин, 95°C – 30 сек, 61°C – 25 сек, 72°C – 30 сек, 40 циклов, 72°C – 3 мин, 25°C – 10 сек.

LIF-T: 5’ – cacctttcactttccttcctcc

5’ – cggcgatgatctgcttatactt

Условия ПЦР: 95°C – 3 мин, 95°C – 30 сек, 62°C – 30 сек, 72°C – 30 сек, 40 циклов, 72°C – 3 мин, 25°C – 10 сек.

SCF: 5’ – ccgaagggatctgcaggaatc

5’ – gtagcttacacttcttgaaactctctctc

Условия ПЦР: 95°C – 3 мин, 95°C – 30 сек, 65°C – 20 сек, 72°C – 30 сек, 40 циклов, 72°C – 3 мин, 25°C – 10 сек.

Для вложенной ПЦР структура праймеров и режимы термоциклирования были следующими:

LIF-D: 5’ – agtgccaatgccctctttatt

5’ – caaggtacacgactatgcggta

LIF-M: 5’ – gcagtgccaatgccctct

5’ – caaggtacacgactatgcggta

LIF-T: 5’ – cacccacctgcctatgacc

5’ – caaggtacacgactatgcggta

Условия ПЦР: 95°C – 3 мин, 95°C – 20 сек, 63°C – 20 сек, 72°C – 20 сек, 20 циклов, 72°C – 3 мин, 25°C – 10 сек.

SCF: 5’ – aaatcattcaagagcccagaaccc

5’ – ccagtataaggctccaaaagcaa

Условия ПЦР: 95°C – 3 мин, 95°C – 20 сек, 62°C – 30 сек, 72°C – 20 сек, 25 циклов, 72°C – 3 мин, 25°C – 10 сек.

^ Статистический анализ результатов. Статистическую обработку результатов исследования проводили, используя анализ таблиц частот и критерий х-квадрат в программе статистической обработки «Statistica 6.0».

^ РЕЗУЛЬТАТЫ И ОБСУЖДЕНИЕ

Экспрессия изоформ мРНК лейкемия-ингибирующего фактора в различных фетальных тканях человека.

В ранее выполненных исследованиях разных авторов экспрессия изоформ LIF в фетальных тканях изучалась лишь у мышей [Haines, 1999]. В нашей работе экспрессию изоформ мРНК LIF исследовали в различных фетальных тканях человека. Для этого получали образцы суммарной РНК, выделенной из ткани печени (n=7), селезенки (n=5), тимуса (n=6), яичников (n=5), семенников (n=4), почки (n=5), мозга (n=7), надпочечников (n=3) и зачатков зубов (n=3).

При анализе продуктов амплификации проводили электрофорез в агарозном геле на каждую изоформу отдельно. В результате вложенной ПЦР транскрипта LIF-D получался продукт размером 166 пар нуклеотидов, LIF-M – 168 п.н. На рисунке 1 проиллюстрированы результаты электрофореза продуктов амплификации LIF-D и LIF-M в различных образцах фетальных тканей и мононуклеарных клетках пуповинной крови новорожденных.

А


Рис. 1. Определение сплайс-форм мРНК LIF-D (А) и мРНК LIF-M (Б) в тканях плодов на сроке гестации 20-22 недель и в клетках пуповинной крови новорожденных. 1, 2, 3 – МНК пуповинной крови, 4, 5 – МНК крови плодов на 18-22 неделе развития, 6 – печень, 7, 8 – семенники, 9, 10 – щит. железа, 11, 12 – надпочечники, 13 – яичники, 14, 15 – ткани мозга, 16 – печень, 17, 18 – ткани десневых карманов, 19 – надпочечники, 20 - печень, 21 – надпочечники, 22 - селезенка. (Б) В результате вложенной амплификации транскрипта LIF-M в фетальных тканях и образцах пуповинной крови выявлялся специфичный фрагмент 168 п.н. М – маркер молекулярного веса pUC19/MspI.


Б

По результатам анализа продуктов амплификации в агарозном геле было выявлено, что экспрессия изоформ мРНК LIF имеет неоднородный характер и встречается не во всех исследуемых тканях. В таблице №1 приведены значения частот встречаемости изоформ LIF в фетальных тканях человека.

Для определения значимости различий в частотах встречаемости экспрессии изоформ был произведен статистический качественный анализ таблиц частоты определения экспрессии по критерию хи-квадрат.

^ Таблица 1.

Частота встречаемости альтернативных транскриптов LIF в фетальных тканях плодов 20-22 недель гестации.



^ Изоформы LIF

hLIF-D раствор.

hLIF-M

мембр.

hLIF-T


Фетальные ткани

Печень

7/7 (100%) *

3/7 (42.86%)

0/7

Тимус

1/6 (16.67%)

0/6 (0%)

0/6

Селезенка

0/5 (0%)

2/5 (40%)

0/5

Яичники

1/5 (20%)

1/5 (20%)

0/5

Семенники

1/4 (25%)

1/4 (25%)

0/4

Почка

0/5 (0%)

0/5 (0%)

0/5

Надпочечники

3/3 (100%)

2/3 (66.67%)

0/3

Мозг

2/7 (28.57%)

5/7(71.4%)

0/7

Зачатки зубов

2/3 (66.67%)

1/3 (33.33%)

0/3

Примечание: числитель дроби – количество выявленных положительных образцов, знаменатель – общее количество образцов.* -p<0,05 между изоформами.


По результатам статистического анализа было выявлено, что достоверным является преобладание экспрессии мРНК LIF-D в печени по сравнению с остальными типами тканей, за исключением тканей зачатков зубов и надпочечников. В зачатках зубов частота встречаемости мРНК LIF-D составляет 66,67%, что так же выше, чем в остальных образцах, но это не является достоверным, что связано с малым количеством образцов. В тканях почки экспрессии LIF не было обнаружено ни в одном из образцов, что совпадает с аналогичными исследованиями на мышах [Robertson, 1993]. В целом при рассмотрении частот экспрессии этих изоформ можно сделать вывод о тенденции в преобладании той или иной изоформы в определенном типе тканей, а именно: мРНК LIF-D чаще всего встречается в тканях печени, надпочечников, зачатков зубов, а мРНК LIF-M - в надпочечниках и тканях мозга.

В печени в период 20-22 недель внутриутробного развития активно идут процессы гемо- и иммунопоэза, одним из важных регуляторов которых является LIF. Экспрессия в печени обеих изоформ, отличающихся по частоте встречаемости, свидетельствует о наличии разных клеток-продуцентов. Экспрессия LIF в тимусе и селезенке не так часто встречается, как в печени и других вышеперечисленных тканях в изучаемый период развития. Вероятно, на сроке гестации 20-22 недели активность клеток-продуцентов LIF в этих органах только развивается и поэтому экспрессия обнаруживается не во всех образцах. По результатам вложенной ПЦР в тимусе встречается только растворимая изоформа мРНК LIF-D (16,7%), а в селезенке – мембранная LIF-M (40%). Это свидетельствует о том, что в процессах иммунопоэза и гистогенеза в этих органах за счет альтернативного сплайсинга изоформы LIF выполняют разные биологические функции и регуляция их экспрессии происходит независимо и по тканеспецифическому принципу. На основании этих данных можно так же предположить, что регуляция развития тимоцитов происходит преимущественно растворимой изоформой LIF-D, а в лимфопоэзе селезенки основную роль играет мембранная изоформа LIF-M. Известно, что с возрастом продукция LIF и SCF возрастает в тимусе, что связано с процессами инволюции тимуса [Sempowski,2000]. Вероятно, поэтому частота встречаемости экспрессии изоформ мРНК LIF на сроке гестации 20-22 недель имеет невысокий уровень. Так же вероятно, в процессах регуляции созревания тимоцитов и в процессах инволюции участвуют разные изоформы мРНК.

В изучаемый период развития активно идет развитие нервной системы, пролиферация и созревание нейронов, где одну из ключевых ролей играет LIF, чем, возможно, и объясняется его выраженная экспрессия в тканях мозга, причем в нашем исследовании чаще наблюдалась экспрессия мембранной изоформы (71,4%), чем растворимой (28,6%), хотя эти различия не были достоверными. По данным литературы известно, что LIF в тканях нервной системы продуцируется в основном клетками микроглии. Вероятно, эти клетки продуцируют мембранную изоформу и действуют паракринно. Учитывая данные литературы о том, что LIF играет одну из важнейших ролей в гаметогенезе, мы включили в исследование и ткани семенников и яичников плодов. В обоих типах образцов тканей наблюдалась экспрессия изоформ LIF – и мембранной, и растворимой – с одинаковой частотой. Это свидетельствует о том, что регуляция гаметогенеза в этих органах происходит под влиянием различных клеток, полиморфных по спектру экспрессии альтернативных изоформ LIF. Известна роль LIF в развитии гипоталамо-гипофизарно-адреналовой системы [Escary, 1993], чем вероятно и объясняется активность экспрессии в надпочечниках. Внутриклеточная изоформа мРНК LIF-T в образцах фетальных тканей не определялась.

Таким образом, показана избирательная экспрессия изоформ мРНК LIF в зависимости от типа тканей на сроке 20-22 недель внутриутробного развития человека. LIF преимущественно экспрессируется в тканях печени, селезенки, мозга, надпочечниках и тканях зачатков зубов. При этом типы преобладающей изоформы в тканях мозга, печени, тимуса и селезенки отличаются, что может указывать на различные биологические функции изоформ мРНК LIF.

^ Экспрессия изоформ мРНК лейкемия-ингибирующего фактора в мононуклеарных клетках человека на разных этапах развития.

Для изучения закономерностей экспрессии в процессе онтогенетического развития организма, на следующем этапе изучали спектр экспрессии изоформ мРНК LIF в мононуклеарных клетках крови в разные периоды развития. Для этого исследовались образцы крови, полученные от плодов 20-22 недель внутриутробного развития, пуповинная кровь новорожденных и венозная кровь взрослых условно-здоровых доноров.

Как следует из данных табл. 2, во всех образцах МНК крови плодов на 20-22 неделях развития выявлялись изоформы мРНК LIF-D и LIF-M и лишь в одном из образцов – LIF-T.

^ Таблица 2.

Частота встречаемости альтернативных транскриптов LIF в МНК крови на разных этапах онтогенеза.


^ Изоформы мРНК LIF

hLIF-D растворимая

hLIF-M

мембранная

hLIF-T

внутриклет.

МНК крови плодов

20-22 недель, n=5

5/5 (100%)*

5/5 (100%)*

1/5 (20%)

МНК пуповинной крови новорожденных, n=13

4/13 (30,8%)

5/13(38,5%)

0/13(0%)

МНК периферической крови взрослых, n=15

0/15

0/15

0/15

Примечание: числитель дроби – количество выявленных положительных образцов, знаменатель – общее количество образцов.


Показаны достоверные различия в частоте встречаемости изоформ в разные периоды развития. Во всех изученных образцах крови, собранных в пренатальном периоде, встречаются изоформы LIF. К моменту рождения частота встречаемости в периферической крови снижается и практически исчезает у взрослых доноров. Причем данная закономерность характерна для обеих изоформ мРНК LIF-D и LIF-M. Вероятно, это связано с тем, что в этот период наблюдается высокая активность процессов роста и развития организма и в крови циркулирует множество различных регуляторных клеток, экспрессирующих факторы роста, такие как LIF. Эти клетки различаются экспрессией альтернативных транскриптов, что так же необходимо для разнонаправленной регуляции клеток-мишеней. Так же наличие в периферической крови обеих изоформ может свидетельствовать об активной миграции клеток-продуцентов LIF из печени, где так же встречаются обе изоформы, в тимус и селезенку и другие ткани. По результатам анализа экспрессии мРНК этого цитокина в МНК, выделенных из пуповинной крови, было показано, что экспрессия LIF носит разнородный характер и отличается у разных новорожденных. При этом в большинстве случаев экспрессия LIF не выявлялась, а в тех образцах, где она была позитивной, выявлялись обе изоформы мРНК LIF-D и LIF-M одновременно. Это свидетельствует о том, что к моменту рождения количество клеток, экспрессирующих LIF в периферической крови уменьшается и они, вероятно, заселяют ткани, где участвуют в дальнейшей регуляции процессов развития. Так же, возможно, снижение встречаемости клеток-продуцентов в крови является проявлением общего снижения активности процессов пролиферации и органогенеза, регулируемых с участием LIF. В МНК периферической крови 15 взрослых доноров транскриптов LIF не было выявлено. По данным других авторов известно, что в некоторых тканях во взрослом периоде изоформы LIF присутствуют, что говорит о том, что продукция LIF в постнатальном периоде в основном осуществляется в тканях [Auernhammer and Melmed, 2000]. Внутриклеточная изоформа мРНК LIF-T была обнаружена лишь в одной из проб периферической крови плодов. Вероятно, что уровень активности экспрессии внутриклеточной изоформы в разных тканях и клетках зависит от различных стимулирующих факторов со стороны микроокружения. То есть ее экспрессия не является конститутивной, а начинается только в ответ на какие-то сигналы.

Таким образом, наблюдается снижение уровня встречаемости экспрессии этих изоформ в пуле мононуклеарных клеток крови от пренатального к постнатальному периодам развития человека. Учитывая вышесказанное, можно предположить, что клетки-продуценты LIF в период внутриутробного развития активно мигрируют в пуле периферической крови, распространяясь по всему организму, а к моменту рождения и некоторое время после этого они заселяют ткани и исчезают из кровотока.

^ Экспрессия изоформ мРНК фактора стволовых клеток в различных фетальных тканях человека.

Ранее исследователями было установлено наличие двух сплайс-форм мРНК SCF в клетках человека, которые кодируют растворимую и мембраносвязанные формы SCF [Huang, 1992]. В нашей работе впервые определялось наличие мРНК двух изоформ SCF в различных тканях гемо- и иммунопоэза, а так же гаметогенеза на этапе внутриутробного развития человека.

В работе исследовались образцы суммарной РНК, выделенной из ткани печени (n=7), селезенки (n=5), тимуса (n=6), яичников (n=5), семенников (n=4), почки (n=5), мозга (n=7), надпочечников (n=3) и зачатков зубов (n=3). Выявление транскриптов изоформ SCF проводили с использованием двухраундной ПЦР с «вложенными» праймерами, для повышения чувствительности и специфичности детекции.

На рисунке 2 представлены результаты детекции продуктов амплификации SCF в агарозном геле.

А
Рис. 2. Определение изоформ мРНК SCF в тканях плодов на сроке гестации 18-20 недель(A) и в клетках пуповинной крови новорожденных (Б). В результате вложенной ПЦР получалось два продукта: 339 п.н. (растворимая изоформа) и 225 п.н.(мембранная изоформа). А. 1, 2 – МНК плодов, 3 – печень, 4, 5 – семенники, 6, 7 – мозг, 8, 9 – надпочечники, 10 - яичники, 11, 12 – мозг, 13 – печень, 14, 15 – зачатки зубов, 16 – надпочечники, 17 – тимус; М – маркер молекулярного веса pUC19/MspI. Б. 1-5 – образцы МНК пуповинной крови от разных доноров.


Б


Ранние исследования показали, что этот фактор является одним из ключевых регуляторов развития тимоцитов, раннего развития предшественников В-лимфоцитов и нормального функционирования системы гемопоэза [Toksoz, 1992; Smith, 2001]. Особо важен тот факт, что ключевую роль в вышеперечисленных функциях выполняет мембраносвязанная изоформа SCF, а направленность регуляторных реакций модулируется как балансом мембранной и растворимой изоформ самого SCF, так и изоформами его рецептора C-KIT. Во всех изученных типах тканей, кроме тканей зачатков зубов, была выявлена экспрессия обеих изоформ мРНК SCF, что свидетельствует о полиморфности клеток-продуцентов фактора в этих тканях и разнонаправленном регуляторном действии этого цитокина в пренатальный период развития. Полученные результаты представлены в таблице №3.

В тканях фетального иммунопоэза и гемопоэза наиболее часто экспрессия обеих изоформ SCF, как и LIF, выявлялась в образцах печени, причем преобладала растворимая форма, что соответствует важной роли этого цитокина как фактора гемопоэза. Преобладание экспрессии изоформ SCF в печени в период 20-22 недель может объясняться тем, что процессы миграции регуляторных клеток в центральные органы иммунопоэза еще не завершились и печень является ключевым органом гемо- и иммунопоэза. Подтверждением этого служит еще тот факт, что в период внутриутробного развития обе изоформы мРНК часто встречаются и в мононуклеарных клетках периферической крови, а во взрослом периоде частота встречаемости этих изоформ в пуле МНК резко уменьшается. При этом по данным литературы в тканях экспрессия изоформ SCF продолжается и во взрослом периоде. Это может быть обусловлено тем, что именно во внутриутробном и неонатальном периодах идут активные процессы миграции клеток-продуцентов этого фактора в ткани, где они потом выполняют свои функции в регуляторных процессах, прежде всего как регуляторы функций стволовых клеток.


^ Таблица 3.

Частота встречаемости сплайс-изоформ мРНК SCF в фетальных тканях плодов 20-22 недель гестации.


^ Фетальные ткани

SCF растворимый

SCF мембранный

Печень

5/7 (71,4%)

4/7 (57,1%)

Тимус

4/6 (66,7%)

2/6 (33,3%)

Селезенка

2/5 (40%)

2/5 (40%)

Яичники

2/5 (40%)

2/5 (40%)

Семенники

3/4 (75%)

3/4 (75%)

Почка

3/5 (60%)

2/5 (40%)

Надпочечники

3/3 (100%)

3/3 (100%)

Мозг

5/7 (71,4%)

5/7 (71,4%)

Зачатки зубов

1/3 (33,3%)

0/3

Примечание: числитель дроби – количество выявленных положительных образцов, знаменатель – общее количество образцов.


Учитывая, что SCF играет важную роль в поддержании пролиферативной активности стволовых клеток, а во время пренатального развития высокая активность пролиферации тканевых стволовых клеток регистрируется в тканях зачатков зубов, представлялось закономерным исследовать наличие изоформ SCF в этих тканях. Однако исследование трех образцов этих тканей показало, в отличие от LIF, что только в одном случае обнаружилась экспрессия растворимой изоформы мРНК SCF. Возможно, это объясняется тем, что уровень экспрессии меняется в течение внутриутробного развития и зависит от срока гестации, а так же более строгой тканеспецифичностью альтернативного сплайсинга в изученном компартменте.

Известно, что SCF играет важную роль в процессах сперматогенеза и оогенеза, регулируя активность половых клеток. Поэтому особо важным было изучение альтернативного сплайсинга мРНК SCF в тканях семенников и яичников. Как видно из данных табл. 3, в этих тканях экспрессируется как растворимая, так и мембранная формы SCF, причем уровень экспрессии обеих изоформ в семенниках и яичниках был сопоставим.

Статистический анализ достоверности показал недостоверные отличия между частотами встречаемости экспрессии изоформ мРНК SCF в фетальных тканях. При этом наблюдалась неоднородность экспрессии изоформ в пределах одного организма. В одном случае у плода в тканях печени выявлялась экспрессия обеих изоформ тогда, как у этого же плода в почках была выявлена только растворимая форма SCF. В другом случае у плода наблюдалась выраженная экспрессия обеих изоформ в семенниках в отличие от тканей зачатков зубов, где экспрессии не было обнаружено. Подобные данные свидетельствуют о тканеспецифическом характере регуляции альтернативного сплайсинга SCF и, возможно, о зависимости экспрессии той или иной формы от физиологического состояния плода.

^ Экспрессия изоформ мРНК фактора стволовых клеток в мононуклеарных клетках человека на разных этапах развития.

На следующем этапе исследований изучались изменения экспрессии мРНК SCF в зависимости от стадии развития организма. С этой целью изучали наличие изоформ мРНК SCF в мононуклеарных клетках крови плодов на 20-22 неделях внутриутробного развития, пуповинной крови новорожденных и периферической крови взрослых.

В изученных образцах МНК плодов выявлялась выраженная экспрессия обеих изоформ мРНК SCF, в то время как в МНК периферической крови взрослых доноров мы не выявили ни растворимую, ни мембранную изоформы. Анализ 13-ти образцов пуповинной крови показал, что в пяти из них экспрессия мРНК SCF была положительной, причем в двух из этих проб обнаруживался фрагмент, соответствующий только мембранной изоформе. Полученные данные суммированы в таблице № 4.

^ Таблица 4.

Частота встречаемости сплайс-изоформ мРНК SCF в МНК крови на разных этапах онтогенеза.



Изоформы мРНК SCF

SCF растворимый

SCF мембранный

МНК крови плодов

20-22 недель, N=5

5/5(100%)

5/5(100%)

МНК пуповинной крови новорожденных, N=13

3/13(23,1%)

5/13(38,5%)

МНК периферической крови взрослых, N=15

0/15

0/15

Примечание: числитель дроби – количество выявленных положительных образцов, знаменатель – общее количество образцов.

Статистический анализ достоверности различий встречаемости экспрессии изоформ SCF на разных этапах онтогенеза показал, что снижение частоты встречаемости растворимой изоформы в неонатальном периоде было статистически значимым (p<0,05), в то время как снижение частоты мембранной формы в этот период развития имело характер выраженной тенденции (p>0,05). Несмотря на практически двукратное увеличение экспрессии мембранной изоформы в пуповинной крови по сравнению с растворимой формой (38,5 против 23,1%, соответственно), эти различия были недостоверными.

Наличие изоформ мРНК фактора стволовых клеток в периферической крови в антенатальный и неонатальный периоды и отсутствие их во взрослом периоде объясняется более активными процессами пролиферации и развития во внутриутробный период, а так же переключением органов гемопоэза, миграцией предшественников в костный мозг и преимущественной локализацией клеток-продуцентов во взрослом периоде в тканях. Причем, небольшое преобладание мембранной изоформы в неонатальный период может быть связано с функциональными особенностями мигрирующих клеток, и свидетельствует о различном биологическом значении изоформ. Возможно, преобладание клеток, экспрессирующих эту изоформу, в периферической крови свидетельствует об активной миграции клеток-предшественников гемо- и иммунопоэза, так как в этот период внутриутробного развития происходит процесс переключения с фетального эритропоэза на неонатальный, активно мигрируют клетки-предшественники тимопоэза и стволовые гемопоэтические клетки.

В результате анализа проведенных исследований можно утверждать, что экспрессия сплайс-вариантов мРНК SCF имеет дифференцированный тканеспецифический характер в пределах одного организма и широко распространена во многих типах тканей в пренатальный период развития человека. Частота и спектр экспрессии изоформ мРНК SCF в мононуклеарных клетках крови указывает на стадиеспецифичность экспрессии этого цитокина и наиболее выражены во внутриутробный период и в периоде новорожденности. Это связано, прежде всего, с тем, что с возрастом основная продукция этого фактора происходит в тканях. Результаты исследования экспрессии генов LIF и SCF в фетальных тканях человека показывают, что экспрессия указанных генов происходит с участием альтернативного сплайсинга. В некоторых случаях спектр сплайс-форм мРНК, выявляемый в фетальных тканях, соответствует спектру сплайс-форм, описанному у взрослого человека. Для генов цитокинов характерна тканеспецифичность экспрессии сплайс-вариантов выявляемая как для разных тканей одного организма, так и для одной ткани разных организмов. Исследование экспрессии сплайс-форм мРНК цитокинов в МНК на разных стадиях онтогенеза свидетельствует о значимом вкладе сплайс-вариантов цитокинов в регуляцию гистогенеза.


ВЫВОДЫ


  1. Показано, что экспрессия гена lif в фетальных тканях человека проходит с участием альтернативного сплайсинга с образованием изоформ мРНК LIF-D и LIF-M и имеет качественные отличия в разных тканях, что свидетельствует о тканеспецифическом характере альтернативного сплайсинга этого фактора.




  1. В мононуклеарных клетках периферической крови человека частота встречаемости экспрессии изоформ мРНК LIF снижается в течение онтогенетического развития, что свидетельствует о снижении экспрессии мРНК LIF в этих клетках в онтогенезе.




  1. Продемонстрировано, что экспрессия обеих изоформ мРНК SCF широко распространена во многих типах фетальных тканей человека и имеет разные частоты встречаемости в зависимости от типа тканей, что указывает на тканеспецифический характер экспрессии этого цитокина.




  1. При изучении экспрессии изоформ мРНК SCF в мононуклеарных клетках периферической крови в пренатальный, неонатальный и постнатальный периоды было выявлено достоверное снижение частоты встречаемости мРНК как мембранной, так и растворимой форм SCF, что свидетельствует о снижении активности экспрессии этого фактора в клетках-продуцентах периферической крови в течение онтогенетического развития.



^ ПУБЛИКАЦИИ ПО ТЕМЕ ДИССЕРТАЦИИ


  1. Садовская В.А., Сенников С.В., Останин А.А., Селедцова Г.В., Силков А.Н., Козлов В.А. Онтогенетические особенности экспрессии изоформ мРНК фактора, ингибирующего лейкоз, в фетальных тканях и мононуклеарных клетках человека // Клеточные технологии в биологии и медицине. – 2009 г. – № 2. – Стр. 85-89.

  2. Садовская В.А., Сенников С.В., Селедцова Г.В., Силков А.Н., Козлов В.А. Особенности экспрессии изоформ мРНК фактора стволовых клеток в фетальных тканях и мононуклеарных клетках на разных этапах развития человека // Клеточные технологии в биологии и медицине. – 2010 г. – № 3. – Стр. 138-141.

  3. Садовская В.А., Самарин Д.М., Селедцова Г.В., Останин А.А., Силков А.Н., Сенников С.В., Козлов В.А. Изучение тканеспецифичности экспрессии альтернативных форм мРНК SCF, LIF в пренатальном периоде развития. // Материалы межрегиональной научно-практической конференции «Дни иммунологии в Сибири». Омский научный вестник. – 2007 г. – №3(61), приложение 2. – Стр. 159.

  4. Садовская В.А., Селедцова Г.В., Останин А.А., Силков А.Н., Сенников С.В., Козлов В.А. Исследование экспрессии изоформ мРНК SCF и LIF в фетальных тканях и в мононуклеарных клетках крови на разных этапах развития человека.// «Российский иммунологический журнал». Материалы Объединенного иммунологического форума, Санкт-Петербург, 2008.– Том 2(11). – №2-3. – стр. 135.



отлично
  1
Ваша оценка:

Похожие:

Особенности экспрессии изоформ мрнк лейкемия-ингибирующего фактора и фактора стволовых клеток в фетальных тканях и мононуклеарных клетках человека на разных стадиях онтогенеза 14. 03. 09 «Клиническая иммунология, аллергология» iconИзучение тканеспецифической экспрессии сплайс-вариантов мрнк il-4 и il-6 у мыши и человека 14. 03.

Особенности экспрессии изоформ мрнк лейкемия-ингибирующего фактора и фактора стволовых клеток в фетальных тканях и мононуклеарных клетках человека на разных стадиях онтогенеза 14. 03. 09 «Клиническая иммунология, аллергология» iconЭкспрессия теломеразы в иммунокомпетентных клетках человека в норме и при иммунопатологических состояниях

Особенности экспрессии изоформ мрнк лейкемия-ингибирующего фактора и фактора стволовых клеток в фетальных тканях и мононуклеарных клетках человека на разных стадиях онтогенеза 14. 03. 09 «Клиническая иммунология, аллергология» iconФенотипические и функциональные свойства мезенхимальных стромальных клеток человека в норме и при

Особенности экспрессии изоформ мрнк лейкемия-ингибирующего фактора и фактора стволовых клеток в фетальных тканях и мононуклеарных клетках человека на разных стадиях онтогенеза 14. 03. 09 «Клиническая иммунология, аллергология» iconМорфологические и иммуногистохимические особенности опухолей человека с мутацией рецептора эпидермального

Особенности экспрессии изоформ мрнк лейкемия-ингибирующего фактора и фактора стволовых клеток в фетальных тканях и мононуклеарных клетках человека на разных стадиях онтогенеза 14. 03. 09 «Клиническая иммунология, аллергология» iconРоль регуляторных т-клеток в иммунопатогенезе туберкулеза легких с множественной лекарственной устойчивостью

Особенности экспрессии изоформ мрнк лейкемия-ингибирующего фактора и фактора стволовых клеток в фетальных тканях и мононуклеарных клетках человека на разных стадиях онтогенеза 14. 03. 09 «Клиническая иммунология, аллергология» iconКрылов андрей Витальевич экспрессия генов фактора роста эндотелия сосудов и тромбоспондина-1 в клетках

Особенности экспрессии изоформ мрнк лейкемия-ингибирующего фактора и фактора стволовых клеток в фетальных тканях и мононуклеарных клетках человека на разных стадиях онтогенеза 14. 03. 09 «Клиническая иммунология, аллергология» iconСравнительная характеристика мезенхимальных стромальных клеток костного мозга, жировой ткани и плаценты

Особенности экспрессии изоформ мрнк лейкемия-ингибирующего фактора и фактора стволовых клеток в фетальных тканях и мононуклеарных клетках человека на разных стадиях онтогенеза 14. 03. 09 «Клиническая иммунология, аллергология» iconРегуляция иммунного гомеостаза при трансплантации аутологичных клеток костного мозга кардиохирургическим

Особенности экспрессии изоформ мрнк лейкемия-ингибирующего фактора и фактора стволовых клеток в фетальных тканях и мононуклеарных клетках человека на разных стадиях онтогенеза 14. 03. 09 «Клиническая иммунология, аллергология» iconИммунотропные свойства синтетических пептидных производных белков фетоплацентарного комплекса человека.

Особенности экспрессии изоформ мрнк лейкемия-ингибирующего фактора и фактора стволовых клеток в фетальных тканях и мононуклеарных клетках человека на разных стадиях онтогенеза 14. 03. 09 «Клиническая иммунология, аллергология» iconОсобенности распределения длины теломер на отдельных хромосомах в лимфоцитах в норме и при иммунопатологических

Разместите кнопку на своём сайте:
Медицина


База данных защищена авторским правом ©MedZnate 2000-2019
обратиться к администрации | правообладателям | пользователям
Документы